-
Categories
-
Pharmaceutical Intermediates
-
Active Pharmaceutical Ingredients
-
Food Additives
- Industrial Coatings
- Agrochemicals
- Dyes and Pigments
- Surfactant
- Flavors and Fragrances
- Chemical Reagents
- Catalyst and Auxiliary
- Natural Products
- Inorganic Chemistry
-
Organic Chemistry
-
Biochemical Engineering
- Analytical Chemistry
-
Cosmetic Ingredient
- Water Treatment Chemical
-
Pharmaceutical Intermediates
Promotion
ECHEMI Mall
Wholesale
Weekly Price
Exhibition
News
-
Trade Service
Recently, the "primers, methods and kits for identifying masu tuna based on SNP molecular markers" researched and invented by Wang Lianzhu of the Yellow Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences has been authorized by the national invention patent, patent number: ZL 2020113958404
.
.
The present invention is based on 2b-RAD simplified genome sequencing end, mining the species-specific SNP site of bluefin tuna, providing a set of primers based on SNP molecular marker identification of masu tuna, comprising a pair of PCR amplification primers and a probe
designed based on the species-specific SNP molecular marker of masu tuna 。 The SNP molecular marker comprises a C base located at position 255 in the SEQ column, a sequence of the upstream primers in a pair of PCR amplification primers is or contains 5'? CCACAACCTCTGAGTCTGAACCT?3', the sequence of downstream primers is or contains 5'? GCAAAGGCTGATAGTAAACAACAAAT?3', the probe is in sequence 5'? TTTCATTCTGCCACTGTG?3' ordinary probe or sequence 5'? Cyclic probes of cattctg(C)ca?3' are labeled with fluorescent reporter groups at the 5' end of the probe and fluorescent quenching groups
at the 3' end.
The present invention can quickly identify or identify the masu tuna, having simple operation, low sampling amount, short detection cycle, good method specificity, high sensitivity characteristics
.
designed based on the species-specific SNP molecular marker of masu tuna 。 The SNP molecular marker comprises a C base located at position 255 in the SEQ column, a sequence of the upstream primers in a pair of PCR amplification primers is or contains 5'? CCACAACCTCTGAGTCTGAACCT?3', the sequence of downstream primers is or contains 5'? GCAAAGGCTGATAGTAAACAACAAAT?3', the probe is in sequence 5'? TTTCATTCTGCCACTGTG?3' ordinary probe or sequence 5'? Cyclic probes of cattctg(C)ca?3' are labeled with fluorescent reporter groups at the 5' end of the probe and fluorescent quenching groups
at the 3' end.
The present invention can quickly identify or identify the masu tuna, having simple operation, low sampling amount, short detection cycle, good method specificity, high sensitivity characteristics
.