echemi logo
Product
  • Product
  • Supplier
  • Inquiry
    Home > Food News > Food Articles > The Institute of Yellow Sea Fisheries, Chinese Academy of Fishery Sciences, "Primers, Methods and Kits for Identification of Masson Tuna Based on SNP Molecular Markers" was authorized by the National Invention Patent

    The Institute of Yellow Sea Fisheries, Chinese Academy of Fishery Sciences, "Primers, Methods and Kits for Identification of Masson Tuna Based on SNP Molecular Markers" was authorized by the National Invention Patent

    • Last Update: 2022-10-02
    • Source: Internet
    • Author: User
    Search more information of high quality chemicals, good prices and reliable suppliers, visit www.echemi.com
    Recently, the "primers, methods and kits for identifying masu tuna based on SNP molecular markers" researched and invented by Wang Lianzhu of the Yellow Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences has been authorized by the national invention patent, patent number: ZL 2020113958404
    .
     
    The present invention is based on 2b-RAD simplified genome sequencing end, mining the species-specific SNP site of bluefin tuna, providing a set of primers based on SNP molecular marker identification of masu tuna, comprising a pair of PCR amplification primers and a probe
    designed based on the species-specific SNP molecular marker of masu tuna 。 The SNP molecular marker comprises a C base located at position 255 in the SEQ column, a sequence of the upstream primers in a pair of PCR amplification primers is or contains 5'? CCACAACCTCTGAGTCTGAACCT?3', the sequence of downstream primers is or contains 5'? GCAAAGGCTGATAGTAAACAACAAAT?3', the probe is in sequence 5'? TTTCATTCTGCCACTGTG?3' ordinary probe or sequence 5'? Cyclic probes of cattctg(C)ca?3' are labeled with fluorescent reporter groups at the 5' end of the probe and fluorescent quenching groups
    at the 3' end.
    The present invention can quickly identify or identify the masu tuna, having simple operation, low sampling amount, short detection cycle, good method specificity, high sensitivity characteristics
    .
    This article is an English version of an article which is originally in the Chinese language on echemi.com and is provided for information purposes only. This website makes no representation or warranty of any kind, either expressed or implied, as to the accuracy, completeness ownership or reliability of the article or any translations thereof. If you have any concerns or complaints relating to the article, please send an email, providing a detailed description of the concern or complaint, to service@echemi.com. A staff member will contact you within 5 working days. Once verified, infringing content will be removed immediately.

    Contact Us

    The source of this page with content of products and services is from Internet, which doesn't represent ECHEMI's opinion. If you have any queries, please write to service@echemi.com. It will be replied within 5 days.

    Moreover, if you find any instances of plagiarism from the page, please send email to service@echemi.com with relevant evidence.